Top » Catalog » SNPs » Z16340

$18.00

Z16340
[Z16340]

Z16340
hg38 Position: ChrY:20909899..20909901
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1a
Comments: Downstream of L513
Forward Primer: Z16340_F GTTGAATCCATTCTTGTTGCTG
Reverse Primer: Z16340_R CCCAAAGTCGGTAGTTTTCG
Reviews (1)

Customers who bought this product also purchased
FGC32805
FGC32805
Z17299
Z17299
FGC13422
FGC13422
Z17626
Z17626
FGC32363
FGC32363
CTS3087
CTS3087
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies