Top » Catalog » SNPs » Z16340

$18.00

Z16340
[Z16340]

Z16340
hg38 Position: ChrY:20909899..20909901
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1a
Comments: Downstream of L513
Forward Primer: Z16340_F GTTGAATCCATTCTTGTTGCTG
Reverse Primer: Z16340_R CCCAAAGTCGGTAGTTTTCG
Reviews (1)

Customers who bought this product also purchased
M343
M343
BY11195
BY11195
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
BY14108
BY14108
S6365
S6365
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies