Top » Catalog » SNPs » YP1014

$18.00

YP1014
[YP1014]

YP1014
hg38 Position: ChrY:17202961..17202961
Ancestral: A
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1014_F GTATTTTATTAGAGATGGGGATTGACC
Reverse Primer: YP1014_R GAACTTCTATGCTGTCTTCTGTAGCC
Reviews

Customers who bought this product also purchased
BY30530
BY30530
Y81602
Y81602
BY62687
BY62687
YP1224
YP1224
YP5190
YP5190
A7925
A7925
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies