Top » Catalog » SNPs » BY154

$18.00

BY154
[BY154]

BY154
hg38 Position: ChrY:12160703..12160703
Ancestral: A
Derived: C
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S756
Forward Primer: BY154_F CAAGAAATAACCATAAAAAATGGGTC
Reverse Primer: BY154_R CTCTGAAGGTATCCAAGCAACA
Reviews

Customers who bought this product also purchased
DF13
DF13
S9767
S9767
FGC23770
FGC23770
A718
A718
DF49
DF49
Y16252
Y16252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies