Top » Catalog » SNPs » BY154

$18.00

BY154
[BY154]

BY154
HG19 Position: ChrY:12160703..12160703
Ancestral: A
Derived: C
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S756
Forward Primer: BY154_F CAAGAAATAACCATAAAAAATGGGTC
Reverse Primer: BY154_R CTCTGAAGGTATCCAAGCAACA
Reviews

Customers who bought this product also purchased
DF41
DF41
FGC28987
FGC28987
Z17614
Z17614
FGC32994
FGC32994
L1335
L1335
S9767
S9767
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies