Top » Catalog » SNPs » BY154

$18.00

BY154
[BY154]

BY154
HG19 Position: ChrY:12160703..12160703
Ancestral: A
Derived: C
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S756
Forward Primer: BY154_F CAAGAAATAACCATAAAAAATGGGTC
Reverse Primer: BY154_R CTCTGAAGGTATCCAAGCAACA
Reviews

Customers who bought this product also purchased
BY3144
BY3144
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY150
BY150
DF41
DF41
Z17614
Z17614
FGC32994
FGC32994
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies