Top » Catalog » SNPs » BY154

$18.00

BY154
[BY154]

BY154
hg38 Position: ChrY:12160703..12160703
Ancestral: A
Derived: C
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S756
Forward Primer: BY154_F CAAGAAATAACCATAAAAAATGGGTC
Reverse Primer: BY154_R CTCTGAAGGTATCCAAGCAACA
Reviews

Customers who bought this product also purchased
Z17614
Z17614
FGC32994
FGC32994
L1335
L1335
A861
A861
S7364
S7364
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies