Top » Catalog » SNPs » BY154

$18.00

BY154
[BY154]

BY154
HG19 Position: ChrY:12160703..12160703
Ancestral: A
Derived: C
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k~
Comments: Below S756
Forward Primer: BY154_F CAAGAAATAACCATAAAAAATGGGTC
Reverse Primer: BY154_R CTCTGAAGGTATCCAAGCAACA
Reviews

Customers who bought this product also purchased
L743
L743
FGC18447
FGC18447
DF13
DF13
FGC32449
FGC32449
FGC23770
FGC23770
A718
A718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies