Top » Catalog » SNPs » FGC18441

$18.00

FGC18441
[FGC18441]

FGC18441
hg38 Position: ChrY:3018813..3018813
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S764
Forward Primer: FGC18441_F CACGATACCCCCTCAAAATC
Reverse Primer: FGC18441_R TTTGGAGCCTAAAGGTGGTC
Reviews

Customers who bought this product also purchased
FGC45280
FGC45280
FGC32994
FGC32994
S695
S695
A7367
A7367
S9767
S9767
FGC18447
FGC18447
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies