Top » Catalog » SNPs » M267

$18.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews

Customers who bought this product also purchased
YSEQ-Beta
YSEQ-Beta
Whole Genome Sequence
Whole Genome Sequence
PF7415
PF7415
Z6064
Z6064
Y22056
Y22056
PF5088
PF5088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies