Top » Catalog » SNPs » M267

$18.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews (1)

Customers who bought this product also purchased
U175
U175
ZS9588
ZS9588
ZS7288
ZS7288
ZS5801
ZS5801
FGC7936
FGC7936
ZS11645
ZS11645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies