Top » Catalog » SNPs » M267

$19.00

M267
[M267]

M267
hg38 Position: ChrY:20579932..20579932
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: J1
Comments: Aka. F4320
Forward Primer: M267v2_F GGTGTTTAAAGAGGATGGACAAG
Reverse Primer: M267v2_R TTTGTAGAGACACGGTTGTACCC
Reviews (4)

Customers who bought this product also purchased
FGC10500
FGC10500
Y211361
Y211361
BY198020
BY198020
Y87984
Y87984
FTA98834
FTA98834
Y25378
Y25378
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies