Top » Catalog » SNPs » FGC5

$17.50

FGC5
[FGC5]

FGC5
HG19 Position: ChrY:18213027..18213027
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
ZS10609
ZS10609
FGC5235
FGC5235
FGC5230
FGC5230
Z642
Z642
ZS4062
ZS4062
BY136
BY136
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies