Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
ZS11116
ZS11116
Y184791
Y184791
ZS11392
ZS11392
FGC85618
FGC85618
ZS7539
ZS7539
ZS7530
ZS7530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies