Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
FGC11759
FGC11759
FGC6
FGC6
FGC48180
FGC48180
Z1865
Z1865
ZS9318
ZS9318
FGC34373
FGC34373
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies