Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
HG19 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
Z18219
Z18219
ZS11130
ZS11130
ZS1820
ZS1820
FGC44943
FGC44943
FGC52341
FGC52341
ZS10800
ZS10800
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies