Top » Catalog » SNPs » FGC5

$18.00

FGC5
[FGC5]

FGC5
HG19 Position: ChrY:18213027..18213027
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
FGC31327
FGC31327
FGC1695
FGC1695
ZS12072
ZS12072
FGC6770
FGC6770
BY145
BY145
FGC4486
FGC4486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies