Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
HG19 Position: ChrY:2781400..2781400
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments:
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FGC16919
FGC16919
ZS8939
ZS8939
ZS12046
ZS12046
FGC6770
FGC6770
ZS8349
ZS8349
ZS12072
ZS12072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies