Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
BY3
BY3
FGC15177
FGC15177
Z18225
Z18225
ZS4753
ZS4753
A14638
A14638
FGC52345
FGC52345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies