Top » Catalog » SNPs » FGC7

$17.50

FGC7
[FGC7]

FGC7
HG19 Position: ChrY:2781400..2781400
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments:
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FGC7393
FGC7393
FGC10095
FGC10095
FGC4309
FGC4309
FGC11755
FGC11755
FGC4314
FGC4314
ZS10722
ZS10722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11766
1 x A11670
1 x A10310
1 x A10509
1 x A11486
1 x A10370
1 x A10316
1 x A11088
1 x A10624
1 x A11145
1 x A10741
1 x A11740
1 x A11690
1 x A10231
1 x A10284
1 x A11244
1 x A11650
1 x A11124
1 x A10960
1 x A1
1 x A10880
1 x A10560
1 x A10666
1 x A10033
1 x A11627
1 x A11590
1 x A1147
1 x A11440
1 x A101
1 x A10615
1 x A11624
1 x A1069
1 x A11279
1 x A11473
1 x A10127
1 x A10934
1 x A10180
1 x A11720
1 x A10024
1 x A11054
1 x A10503
1 x A11538
1 x A11375
1 x A10927
1 x A10561
1 x A10674
1 x A1030
1 x A11174
1 x A11785
$857.50
Haplogroup Info
Other products
Currencies