Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
ZS4753
ZS4753
A12919
A12919
A14638
A14638
FGC52345
FGC52345
ZS5801
ZS5801
FGC42837
FGC42837
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies