Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
HG19 Position: ChrY:2781400..2781400
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments:
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FGC5419
FGC5419
FGC1703
FGC1703
ZS5814
ZS5814
ZS5809
ZS5809
ZS11521
ZS11521
FGC1715
FGC1715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies