Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FGC1705
FGC1705
ZS7282
ZS7282
ZS5804
ZS5804
M168
M168
ZS9588
ZS9588
ZS7288
ZS7288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies