Top » Catalog » SNPs » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FT50816
FT50816
Y171687
Y171687
BY189399
BY189399
ZS10535
ZS10535
ZS9106
ZS9106
ZS9101
ZS9101
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies