Top » Catalog » SNPs » A6091

$18.00

A6091
[A6091]

A6091
hg38 Position: ChrY:8510702..8510702
Ancestral: T
Derived: G
Reference: Ross Buchanan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695 > FGC32575
Forward Primer: A6091_F GCTTTTTCCCCTTAATGCTTG
Reverse Primer: A6091_R GGCATAAAACCAAAAGGAAATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC66926
FGC66926
A9012
A9012
S695
S695
A9019
A9019
S691
S691
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies