Top » Catalog » SNPs » A6091

$18.00

A6091
[A6091]

A6091
hg38 Position: ChrY:8510702..8510702
Ancestral: T
Derived: G
Reference: Ross Buchanan (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S691 > S695 > FGC32575
Forward Primer: A6091_F GCTTTTTCCCCTTAATGCTTG
Reverse Primer: A6091_R GGCATAAAACCAAAAGGAAATG
Reviews

Customers who bought this product also purchased
S744
S744
FGC32580
FGC32580
A9880
A9880
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
FGC32575
FGC32575
A9012
A9012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies