Top » Catalog » SNPs » FGC1041

$18.00

FGC1041
[FGC1041]

FGC1041
hg38 Position: ChrY:8403541..8403541
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a1a (not listed)
Comments: Below L293
Forward Primer: FGC1041_F AAAACTGCCTTGACACCCAG
Reverse Primer: FGC1041_R TGGGTTCTTTTCTCCTGAGTTG
Reviews

Customers who bought this product also purchased
Z7952
Z7952
A6095
A6095
Z7954
Z7954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies