Top » Catalog » SNPs » Z7952

$18.00

Z7952
[Z7952]

Z7952
hg38 Position: ChrY:12322768..12322768
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a1a1a1a1b
Comments: Found in a G-L293 person
Forward Primer: Z7952_F CTCAACTGTTAGCATTACAATGTCTG
Reverse Primer: Z7952_R GGCCTTGATACATAATTTAGTCTTGTTAC
Reviews

Customers who bought this product also purchased
Z7954
Z7954
A6095
A6095
FGC1041
FGC1041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies