Top » Catalog » SNPs » Y15659

$18.00

Y15659
[Y15659]

Y15659
HG19 Position: ChrY:16511871..16511871
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2a1a1a (not listed)
Comments: Downstream CTS12005
Forward Primer: Y15659_F CCAGCCATGGGTCAACTAAC
Reverse Primer: Y15659_R TTGCTGGTTGTCTCAGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies