Top » Catalog » SNPs » YP1182

$18.00

YP1182
[YP1182]

YP1182
hg38 Position: ChrY:3006789..3006789
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream YP515
Forward Primer: YP1182_F CTTTCCTAGCCAGCTTGCAC
Reverse Primer: YP1182_R TCACCAGCACAACTTTCTCG
Reviews

Customers who bought this product also purchased
DYS464
DYS464
CTS11962
CTS11962
YP1337
YP1337
YP254
YP254
M458
M458
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies