Top » Catalog » SNPs » YP1569

$18.00

YP1569
[YP1569]

YP1569
hg38 Position: ChrY:14481650..14481650
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1569_F GGTTGAATTAAAACTAAATAAAATGATAATCC
Reverse Primer: YP1569_R AGAACTTTGAGAAGCCTAGGCAG
Reviews

Customers who bought this product also purchased
Y4135
Y4135
M458
M458
YP414
YP414
Z93
Z93
Y2905
Y2905
YP4559
YP4559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies