Top » Catalog » SNPs » YP3943

$18.00

YP3943
[YP3943]

YP3943
hg38 Position: ChrY:7851414..7851414
Ancestral: G
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: Q1b2a1a1
Comments: Below Y1150
Forward Primer: YP3943_F CAGTATGCTTCTACTACCCTCAGG
Reverse Primer: YP3943_R CATTCACCTCAGTGGCAAAG
Reviews

Customers who bought this product also purchased
M25
M25
YP3941
YP3941
L275
L275
YP755
YP755
M242
M242
Y2079
Y2079
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies