Top » Catalog » SNPs » YP3943

$18.00

YP3943
[YP3943]

YP3943
hg38 Position: ChrY:7851414..7851414
Ancestral: G
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: Q1b2a1a1
Comments: Below Y1150
Forward Primer: YP3943_F CAGTATGCTTCTACTACCCTCAGG
Reverse Primer: YP3943_R CATTCACCTCAGTGGCAAAG
Reviews

Customers who bought this product also purchased
Y2079
Y2079
L56
L56
Y2200
Y2200
Q Superclade Panel
Q Superclade Panel
Q1b-L275 Panel
Q1b-L275 Panel
M25
M25
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies