Top » Catalog » SNPs » A6105

$18.00

A6105
[A6105]

A6105
hg38 Position: ChrY:19673765..19673765
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a1b2a1b
Comments: Downstream Y4460
Forward Primer: A6105_F TGATGGCAGATGGATGTCTC
Reverse Primer: A6105_R TCAGGGAATGGTGTGACTTG
Reviews

Customers who bought this product also purchased
Y18331
Y18331
Y125625
Y125625
Y90421
Y90421
CTS10228
CTS10228
Y5598
Y5598
Y39363
Y39363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies