Top » Catalog » SNPs » A6109

$18.00

A6109
[A6109]

A6109
hg38 Position: ChrY:7871016..7871016
Ancestral: G
Derived: A
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6109_F CACGACATCACGCATGTTC
Reverse Primer: A6109_R CCTGCTTTCTTTGGAAATGG
Reviews

Customers who bought this product also purchased
YFS523985
YFS523985
A10163
A10163
A6111
A6111
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10162
A10162
A6110
A6110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies