Top » Catalog » SNPs » A6109

$18.00

A6109
[A6109]

A6109
hg38 Position: ChrY:7871016..7871016
Ancestral: G
Derived: A
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6109_F CACGACATCACGCATGTTC
Reverse Primer: A6109_R CCTGCTTTCTTTGGAAATGG
Reviews

Customers who bought this product also purchased
YFS563949
YFS563949
A10160
A10160
A6107
A6107
YFS563926
YFS563926
YFS523972
YFS523972
A10164
A10164
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies