Top » Catalog » SNPs » A6110

$18.00

A6110
[A6110]

A6110
hg38 Position: ChrY:20849021..20849021
Ancestral: G
Derived: A
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6110_F GGAATCACCTGCCTTCTGTG
Reverse Primer: A6110_R ACTGTGCACATGTACCCTAAAGTTC
Reviews

Customers who bought this product also purchased
YFS563951
YFS563951
YFS523985
YFS523985
A10163
A10163
YFS563949
YFS563949
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10162
A10162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies