Top » Catalog » SNPs » A6112

$18.00

A6112
[A6112]

A6112
hg38 Position: ChrY:14632078..14632078
Ancestral: T
Derived: C
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6112_F AGTGACTCACCTTTTGAATGTACG
Reverse Primer: A6112_R GCTCTTTTAAAAAGTGTTACTTTTCCTG
Reviews

Customers who bought this product also purchased
YFS563949
YFS563949
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10162
A10162
YFS563926
YFS563926
A10161
A10161
A6109
A6109
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies