Top » Catalog » SNPs » A6112

$18.00

A6112
[A6112]

A6112
hg38 Position: ChrY:14632078..14632078
Ancestral: T
Derived: C
Reference: Douglas Phelps (2015)
ISOGG Haplogroup: E1a1 (not listed)
Comments: .
Forward Primer: A6112_F AGTGACTCACCTTTTGAATGTACG
Reverse Primer: A6112_R GCTCTTTTAAAAAGTGTTACTTTTCCTG
Reviews

Customers who bought this product also purchased
A10161
A10161
A6109
A6109
A10160
A10160
A6107
A6107
YFS523972
YFS523972
A10164
A10164
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies