Top » Catalog » SNPs » L140

$18.00

L140
[L140]

L140
hg38 Position: ChrY:7702818..7702818
Ancestral: ins
Derived: del
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1
Comments: Downstream of G-P303
Forward Primer: L140_F TAGTATTTCTGTTTCAGGCTGGATG
Reverse Primer: L140_R CTGATGTAGTCAGATCTTTGTTTTACATTAC
Reviews

Customers who bought this product also purchased
Z6211
Z6211
Z6494
Z6494
FGC5672
FGC5672
Z6805
Z6805
FGC5711
FGC5711
Z6350
Z6350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies