Top » Catalog » SNPs » L140

$18.00

L140
[L140]

L140
hg38 Position: ChrY:7702818..7702818
Ancestral: ins
Derived: del
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1
Comments: Downstream of G-P303
Forward Primer: L140_F TAGTATTTCTGTTTCAGGCTGGATG
Reverse Primer: L140_R CTGATGTAGTCAGATCTTTGTTTTACATTAC
Reviews

Customers who bought this product also purchased
M267
M267
M406
M406
M438
M438
U8
U8
M9
M9
L1259
L1259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies