Top » Catalog » SNPs » L140

$18.00

L140
[L140]

L140
hg38 Position: ChrY:7702818..7702818
Ancestral: ins
Derived: del
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1
Comments: Downstream of G-P303
Forward Primer: L140_F TAGTATTTCTGTTTCAGGCTGGATG
Reverse Primer: L140_R CTGATGTAGTCAGATCTTTGTTTTACATTAC
Reviews

Customers who bought this product also purchased
Z6350
Z6350
S11726
S11726
Z6343
Z6343
CTS9957
CTS9957
Z6354
Z6354
Z6029
Z6029
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies