Top » Catalog » SNPs » L140

$18.00

L140
[L140]

L140
hg38 Position: ChrY:7702818..7702818
Ancestral: ins
Derived: del
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1
Comments: Downstream of G-P303
Forward Primer: L140_F TAGTATTTCTGTTTCAGGCTGGATG
Reverse Primer: L140_R CTGATGTAGTCAGATCTTTGTTTTACATTAC
Reviews

Customers who bought this product also purchased
M89
M89
L91
L91
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M201
M201
PF3180
PF3180
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies