Top » Catalog » SNPs » L140

$18.00

L140
[L140]

L140
hg38 Position: ChrY:7702818..7702818
Ancestral: ins
Derived: del
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: G2a2b2a1
Comments: Downstream of G-P303
Forward Primer: L140_F TAGTATTTCTGTTTCAGGCTGGATG
Reverse Primer: L140_R CTGATGTAGTCAGATCTTTGTTTTACATTAC
Reviews

Customers who bought this product also purchased
BY96988
BY96988
Y248931
Y248931
M9330
M9330
Z45044
Z45044
DNA Sample Kit
DNA Sample Kit
Z17084
Z17084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies