Top » Catalog » SNPs » Y4460

$18.00

Y4460
[Y4460]

Y4460
hg38 Position: ChrY:9191221..9191221
Ancestral: G
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: I2a1b2a1b
Comments: Subclade of I-CTS5966 CTS10228
Forward Primer: Y4460_F ATGGCATGAATCTGGGATGT
Reverse Primer: Y4460_R TTTTTTTTTTTTAGTTGAGACTGGG
Reviews

Customers who bought this product also purchased
A6036
A6036
A6105
A6105
S2679
S2679
A7318
A7318
FGC12095
FGC12095
FT256413
FT256413
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies