Top » Catalog » SNPs » Y4460

$18.00

Y4460
[Y4460]

Y4460
hg38 Position: ChrY:9191221..9191221
Ancestral: G
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: I2a1b2a1b
Comments: Subclade of I-CTS5966 CTS10228
Forward Primer: Y4460_F ATGGCATGAATCTGGGATGT
Reverse Primer: Y4460_R TTTTTTTTTTTTAGTTGAGACTGGG
Reviews

Customers who bought this product also purchased
A7134
A7134
A10959
A10959
Y90421
Y90421
Y39363
Y39363
Y141127
Y141127
Y100616
Y100616
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies