Top » Catalog » SNPs » Z2539

$15.00

Z2539
[Z2539]

Z2539
hg38 Position: ChrY:15331840..15331840
Ancestral: A
Derived: G
Reference: Centurion [aka Maximus]
ISOGG Haplogroup: I1a2a1e~
Comments: Downstream of Z61. Z62 and upstream of L1248
Forward Primer: Z2539_F CATGGTGCCCCAAGAATG
Reverse Primer: Z2539_R CACCAGCTCCTTTCCACAAC
Reviews

Customers who bought this product also purchased
S6270
S6270
A6471
A6471
S6277
S6277
S6402
S6402
BY1254
BY1254
A6397
A6397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies