Top » Catalog » SNPs » Z2539

$18.00

Z2539
[Z2539]

Z2539
hg38 Position: ChrY:15331840..15331840
Ancestral: A
Derived: G
Reference: Centurion [aka Maximus]
ISOGG Haplogroup: I1a2a1e~
Comments: Downstream of Z61. Z62 and upstream of L1248
Forward Primer: Z2539_F CATGGTGCCCCAAGAATG
Reverse Primer: Z2539_R CACCAGCTCCTTTCCACAAC
Reviews

Customers who bought this product also purchased
Y3649
Y3649
Y5497
Y5497
A5989
A5989
A13241
A13241
Y3647
Y3647
BY126
BY126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies