Top » Catalog » SNPs » Z2539

$18.00

Z2539
[Z2539]

Z2539
hg38 Position: ChrY:15331840..15331840
Ancestral: A
Derived: G
Reference: Centurion [aka Maximus]
ISOGG Haplogroup: I1a2a1e~
Comments: Downstream of Z61. Z62 and upstream of L1248
Forward Primer: Z2539_F CATGGTGCCCCAAGAATG
Reverse Primer: Z2539_R CACCAGCTCCTTTCCACAAC
Reviews

Customers who bought this product also purchased
FGC9532
FGC9532
Y6228
Y6228
L1237
L1237
Y3976
Y3976
S2077
S2077
S15301
S15301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies