Top » Catalog » SNPs » Z2539

$18.00

Z2539
[Z2539]

Z2539
hg38 Position: ChrY:15331840..15331840
Ancestral: A
Derived: G
Reference: Centurion [aka Maximus]
ISOGG Haplogroup: I1a2a1e~
Comments: Downstream of Z61. Z62 and upstream of L1248
Forward Primer: Z2539_F CATGGTGCCCCAAGAATG
Reverse Primer: Z2539_R CACCAGCTCCTTTCCACAAC
Reviews

Customers who bought this product also purchased
FGC23806
FGC23806
A11152
A11152
S26062
S26062
A14608
A14608
S2122
S2122
Y25790
Y25790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies