Top » Catalog » SNPs » Z2539

$18.00

Z2539
[Z2539]

Z2539
hg38 Position: ChrY:15331840..15331840
Ancestral: A
Derived: G
Reference: Centurion [aka Maximus]
ISOGG Haplogroup: I1a2a1e~
Comments: Downstream of Z61. Z62 and upstream of L1248
Forward Primer: Z2539_F CATGGTGCCCCAAGAATG
Reverse Primer: Z2539_R CACCAGCTCCTTTCCACAAC
Reviews

Customers who bought this product also purchased
BY126
BY126
FGC39940
FGC39940
I1-Z63 "Continental" Panel
I1-Z63 "Continental" Panel
S10360
S10360
Y7627
Y7627
FGC9532
FGC9532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies