Top » Catalog » SNPs » A6269

$18.00

A6269
[A6269]

A6269
hg38 Position: ChrY:13569707..13569707
Ancestral: C
Derived: A
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6269_F ATGGCATTTTGCTGGTTTTC
Reverse Primer: A6269_R AAAGAGCACAAAGCCAGAGG
Reviews

Customers who bought this product also purchased
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
A6274
A6274
A6271
A6271
A6277
A6277
A6272
A6272
A6276
A6276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies