Top » Catalog » SNPs » A6271

$18.00

A6271
[A6271]

A6271
hg38 Position: ChrY:19729817..19729817
Ancestral: T
Derived: C
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6271_F CTAGCAGGAACGGGACTGAG
Reverse Primer: A6271_R GAAGTGGAATTGAACGATACTCTG
Reviews

Customers who bought this product also purchased
A6276
A6276
A6269
A6269
A6275
A6275
A6268
A6268
A6273
A6273
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S18605
1 x M128
$36.00
Haplogroup Info
Other products
Currencies