Top » Catalog » SNPs » A6272

$18.00

A6272
[A6272]

A6272
hg38 Position: ChrY:8625580..8625580
Ancestral: A
Derived: G
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6272_F AAATTGGGACACTGGCTGAG
Reverse Primer: A6272_R AACTTCCACCCGAACATCAG
Reviews

Customers who bought this product also purchased
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
A6274
A6274
A6271
A6271
A6277
A6277
A6270
A6270
A6276
A6276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S18605
1 x M128
$36.00
Haplogroup Info
Other products
Currencies