Top » Catalog » SNPs » A6273

$18.00

A6273
[A6273]

A6273
hg38 Position: ChrY:9253763..9253763
Ancestral: T
Derived: C
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6273_F TGCTCTCACCTTGAAGAACATTC
Reverse Primer: A6273_R TGAGGCAGGAGAATTGCTG
Reviews

Customers who bought this product also purchased
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
A6271
A6271
A6272
A6272
A6277
A6277
A6270
A6270
A6276
A6276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies