Top » Catalog » SNPs » A6275

$18.00

A6275
[A6275]

A6275
hg38 Position: ChrY:19919464..19919464
Ancestral: T
Derived: A
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6275v2_F GAAACTTATGGCAAAATTTTCATG
Reverse Primer: A6275v2_R GGTACAGACATTGGGTAAATTTCC
Reviews

Customers who bought this product also purchased
A6276
A6276
A6269
A6269
A6273
A6273
A6268
A6268
A6274
A6274
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22571
1 x A14776
$36.00
Haplogroup Info
Other products
Currencies