Top » Catalog » SNPs » YFS449079

$18.00

YFS449079
[YFS449079]

YFS449079
hg38 Position: ChrY:15207976..15207976
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: Q1a2a1a2 (not listed)
Comments: .
Forward Primer: YFS449079_F GGGTGCATGCCTGTAATCC
Reverse Primer: YFS449079_R CTGGGCTCCAAGAATAGTGG
Reviews

Customers who bought this product also purchased
L14
L14
PF7562
PF7562
Z2103
Z2103
L143
L143
F2437
F2437
Z16501
Z16501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies