Top » Catalog » SNPs » YFS449079

$18.00

YFS449079
[YFS449079]

YFS449079
hg38 Position: ChrY:15207976..15207976
Ancestral: T
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: Q1a2a1a2 (not listed)
Comments: .
Forward Primer: YFS449079_F GGGTGCATGCCTGTAATCC
Reverse Primer: YFS449079_R CTGGGCTCCAAGAATAGTGG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
F2437
F2437
Z16501
Z16501
Y23481
Y23481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies