Top » Catalog » SNPs » A6289

$18.00

A6289
[A6289]

A6289
hg38 Position: ChrY:19978763..19978763
Ancestral: G
Derived: T
Reference: Timo Rossi (2015)
ISOGG Haplogroup: R1b1a2a1a2d (not listed)
Comments: Below L238
Forward Primer: A6289_F GGGCTGTTGTTCCAGAGATG
Reverse Primer: A6289_R TGGCCCAGAGACATTTCC
Reviews

Customers who bought this product also purchased
Z2248
Z2248
L238
L238
Y10827
Y10827
BY25454
BY25454
R1b-L238 Panel
R1b-L238 Panel
Y29875
Y29875
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies